Human genome

Results: 3083



#Item
601Biology / Human genome / ENCODE / Genome / Computational genomics / Bioinformatics / Genetics / Genomics

GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA

Add to Reading List

Source URL: bejerano.stanford.edu

Language: English - Date: 2014-10-09 03:02:55
602Genetics / Gene expression / DNA / HNF1A / Conserved non-coding sequence / Promoter / Human genome / Hepatocyte nuclear factor 4 alpha / Gene / Biology / Transcription factors / Molecular biology

7092–7102 Nucleic Acids Research, 2011, Vol. 39, No. 16 doi:nar/gkr404 Published online 26 MayConservation of transcription factor binding events

Add to Reading List

Source URL: klab.tch.harvard.edu

Language: English - Date: 2011-12-30 11:23:02
603Genomics / Molecular biology / DNA sequencing / DNA / The Genome Institute / Full genome sequencing / Wellcome Trust Sanger Institute / Human Microbiome Project / Human genome / Biology / Genetics / Bioinformatics

Genome Biology 2011, 12(Suppl 1) http://genomebiology.com/supplements/12/S1 M E E T I N G A B S T R AC T S Beyond the Genome 2011

Add to Reading List

Source URL: www.genomebiology.com

Language: English
604Genomics / DNA / Molecular biology / Galaxy / Single-nucleotide polymorphism / Full genome sequencing / Human genome / Biology / Genetics / Bioinformatics

Hiltemann et al. GigaScience 2014, 3:1 http://www.gigasciencejournal.com/contentTE CH N I CAL N O TE Open Access

Add to Reading List

Source URL: www.gigasciencejournal.com

Language: English
605Proteomics / Nutrition / Molecular biology / Statistical coupling analysis / Adaptive evolution in the human genome / Biology / Bioinformatics / Proteins

The Evolutionary “Design” of Proteins Rama Ranganathan The Green Center for Systems Biology, UT Southwestern Medical Center, Dallas TX, Natural proteins can fold spontaneously into well-defined three-dimension

Add to Reading List

Source URL: q-bio.org

Language: English - Date: 2013-07-17 14:49:43
606Fertility medicine / Deaf culture / Deafness / Audiology / Identity politics / Cochlear implant / Disability / Hearing impairment / Preimplantation genetic diagnosis / Medicine / Health / Biology

Education and debate Deaf lesbians, “designer disability,” and the future of medicine Julian Savulescu With the completion of the human genome project, the genetic basis of disease is becoming better

Add to Reading List

Source URL: www.ncbi.nlm.nih.gov

Language: English
607Genomics / Molecular biology / Molecular genetics / Ridge / Genomic imprinting / UniGene / Gene / Human genome / Transcriptome / Biology / Genetics / Gene expression

A gene atlas of the mouse and human protein-encoding transcriptomes Andrew I. Su*†, Tim Wiltshire*†, Serge Batalov*†, Hilmar Lapp*, Keith A. Ching*, David Block*, Jie Zhang*, Richard Soden*, Mimi Hayakawa*, Gabriel

Add to Reading List

Source URL: klab.tch.harvard.edu

Language: English - Date: 2011-12-30 12:08:30
608Cytogenetics / Syndromes / Chromosome / Human genome / Human genetics / Karyotype / XYY syndrome / Isodicentric 15 / 1q21.1 duplication syndrome / Biology / Genetics / Philosophy of biology

Charity No Legal and Administrative Details For the Year Ended 31 March 2006 Status

Add to Reading List

Source URL: www.rarechromo.org

Language: English - Date: 2006-07-13 14:20:12
609Genomics / Gastrointestinal cancer / Emerging technologies / Tay–Sachs disease / Personalized medicine / Genetic testing / Familial dysautonomia / GeneDx / Human genome / Medicine / Biology / Genetics

Evaluating the Utility of Genetic Panels

Add to Reading List

Source URL: blue.regence.com

Language: English - Date: 2015-04-30 18:01:33
610Chromosomes / Cytogenetics / Human genetics / Chromosome 2 / Chimpanzee genome project / Human genome / Chromosome / Karyotype / Centromere / Genetics / Biology / Human evolution

INQUIRY & I N V E S T I G AT I O N Chromosome Connections: Compelling Clues to Common Ancestry

Add to Reading List

Source URL: www.indiana.edu

Language: English - Date: 2014-01-04 18:05:31
UPDATE